Why are we interested in patterns?

Introductie tot Bioconductor in R

James Chapman

Curriculum Manager, DataCamp

sequence patterns

What can we find with patterns?

Gene start
Protein end
Regions that enhance or silence gene expression
Conserved regions between organisms
Genetic variation

Pattern matching

Biostrings provides functions for pattern matching
matchPattern(pattern, subject)
- 1 string to 1 string
vmatchPattern(pattern, subject)
- 1 set of strings to 1 string
- 1 string to a set of strings

Palindromes

never odd or even

findPalindromes() # find palindromic regions in a single sequence

Not new biology

The Genetic code was first described by Nirenberg in 1963 On the coding of genetic information Nirenberg, Marshall et al. Cold Spring Harb Symp Quant Biol 1963, 28
How translation might differ according to the reading frame, was first described by Streisinger in 1966 Frameshift Mutations and the Genetic Code Streisinger, George et al. Cold Spring Harb Symp Quant Biol 1966, 31: 77-84

# Original dna sequence
[1]    30 ACATGGGCCTACCATGGGAGCTACGAAGCC

# 6 possible reading frames, DNAStringSet
[1]    30 ACATGGGCCTACCATGGGAGCTACGAAGCC             + 1     
[2]    30 GGCTTCGTAGCTCCCATGGTAGGCCCATGT             - 1     
[3]    29  CATGGGCCTACCATGGGAGCTACGAAGCC             + 2     
[4]    29  GCTTCGTAGCTCCCATGGTAGGCCCATGT             - 2     
[5]    28   ATGGGCCTACCATGGGAGCTACGAAGCC             + 3     
[6]    28   CTTCGTAGCTCCCATGGTAGGCCCATGT             - 3

# 6 possible translations, AAStringSet
[1]    10 TWAYHGSYEA                                 + 1     
[2]    10 GFVAPMVGPC                                 - 1     
[3]     9 HGPTMGATK                                  + 2
[4]     9 AS*LPW*AH                                  - 2
[5]     9 MGLPWELRS                                  + 3
[6]     9 LRSSHGRPM                                  - 3

Conserved regions in the Zika virus

zika blocks Adapted figure From Mosquitos to Humans: Genetic Evolution of Zika Virus Wang, Lulan et al. Cell Host & Microbe 2016, Vol 19 5: 561-565

Facts

The Zika Virus has a positive strand genome
It lives in humans, monkeys, and mosquitoes
The Flaviviruses family and share 11 conserved proteins

Let's practice finding patterns!

Introductie tot Bioconductor in R