Why are we interested in patterns?

Giới thiệu Bioconductor trong R

James Chapman

Curriculum Manager, DataCamp

sequence patterns

Giới thiệu Bioconductor trong R

What can we find with patterns?

  • Gene start
  • Protein end
  • Regions that enhance or silence gene expression
  • Conserved regions between organisms
  • Genetic variation
Giới thiệu Bioconductor trong R

Pattern matching

  • Biostrings provides functions for pattern matching

  • matchPattern(pattern, subject)

    • 1 string to 1 string
  • vmatchPattern(pattern, subject)

    • 1 set of strings to 1 string
    • 1 string to a set of strings
Giới thiệu Bioconductor trong R

Palindromes

never odd or even

findPalindromes() # find palindromic regions in a single sequence
Giới thiệu Bioconductor trong R

Not new biology

  • The Genetic code was first described by Nirenberg in 1963 On the coding of genetic information Nirenberg, Marshall et al. Cold Spring Harb Symp Quant Biol 1963, 28

  • How translation might differ according to the reading frame, was first described by Streisinger in 1966 Frameshift Mutations and the Genetic Code Streisinger, George et al. Cold Spring Harb Symp Quant Biol 1966, 31: 77-84

Giới thiệu Bioconductor trong R
# Original dna sequence
[1]    30 ACATGGGCCTACCATGGGAGCTACGAAGCC
# 6 possible reading frames, DNAStringSet
[1]    30 ACATGGGCCTACCATGGGAGCTACGAAGCC             + 1     
[2]    30 GGCTTCGTAGCTCCCATGGTAGGCCCATGT             - 1     
[3]    29  CATGGGCCTACCATGGGAGCTACGAAGCC             + 2     
[4]    29  GCTTCGTAGCTCCCATGGTAGGCCCATGT             - 2     
[5]    28   ATGGGCCTACCATGGGAGCTACGAAGCC             + 3     
[6]    28   CTTCGTAGCTCCCATGGTAGGCCCATGT             - 3
# 6 possible translations, AAStringSet
[1]    10 TWAYHGSYEA                                 + 1     
[2]    10 GFVAPMVGPC                                 - 1     
[3]     9 HGPTMGATK                                  + 2
[4]     9 AS*LPW*AH                                  - 2
[5]     9 MGLPWELRS                                  + 3
[6]     9 LRSSHGRPM                                  - 3
Giới thiệu Bioconductor trong R

Conserved regions in the Zika virus

zika blocks Adapted figure From Mosquitos to Humans: Genetic Evolution of Zika Virus Wang, Lulan et al. Cell Host & Microbe 2016, Vol 19 5: 561-565

Facts

  • The Zika Virus has a positive strand genome
  • It lives in humans, monkeys, and mosquitoes
  • The Flaviviruses family and share 11 conserved proteins
Giới thiệu Bioconductor trong R

Let's practice finding patterns!

Giới thiệu Bioconductor trong R

Preparing Video For Download...